VIR-3434 Phase 1-study made by Vir Biotechnology

VIR-3434 is the name of a monoclonal antibody therapy (mca). It has been offered to me 2 days ago. I have time to answer till june, 21, 2022. It has been tested already successfully
with 40 healthy volunteers and 40 hbv-patients with suppressed viral load. The HBs Antigen has been reduced significantly. https://investors.vir.bio/node/8341/pdf

Because i want to minimise risks i would like to know which serious adverse events are possible when i get mca in my body. The study had no grade 3 or 4 adverse events yet. What are your opinions?

My viral load from 20.may.2022 was 2320 IU/ml. I am HBe-Antigen negative. My blood group is A+. I did not take Tenofovir yet. They took some blood samples in the university hospital 2 days ago. The test from may was at the medical office of my brother in law.
I am still not vaccinated with mRNA-Vaccine. I take supplements.

The combined therapy VIR-2218 + VIR-3434 is in phase 2. Development Pipeline | Vir Biotechnology

1 Like

is this NAPs ?? @availlant
which country you are taking part

2 Likes

It is in Essen/Germany. Nucleid Acid Polymer (NAP) is used by Replicor.

1 Like

Dear Koreaner81,

Correct regarding VIR-3434 and NAPs (REP 2139-Mg).

It is important to be careful and set expectations when assessing HBsAg response to therapy. While the HBsAg reductions achieved with VIR-3434 are “statistically significant”, they are not clinically significant in terms of potential to achieve functional cure.

Large clinical studies with pegIFN and phase II studies with NAPs demonstrate that a >4 log reduction in HBsAg from baseline during therapy is required to achieve functional cure of HBV infection.

This was verified last November with a large phase IIB study with combination therapy including an RNAi (JNJ-3938) where no patient achieved functional cure with 2-3 log declines in HBsAg. In fact, HBV rebound was observed following removal of therapy in this trial.

There will be no significant safety issues with enrolling in the VIR-3434 trial, but I would advise that you start NUC therapy (preferably TDF or TAF) regardless of your participation.

Early initiation of NUC therapy has been shown to be much better in preventing the development of liver cancer.

Best regards,

4 Likes

The results in the mouse-models are encouraging if the dose will be increased in human studys. " Poster Presentations – VIR-3434
Preliminary blinded safety and tolerability results and HBsAg data from a Phase 1 trial evaluating VIR-3434 in 24 virally suppressed adults with chronic HBV infection who were randomized to receive a single dose of either 6 mg, 18 mg, 75 mg or placebo demonstrated:

  • A single dose of 6 to 75 mg of VIR-3434 resulted in rapid HBsAg reductions of >1 log10 IU/mL in most participants within approximately 1 week post-dose.
  • The largest (>2 log10 IU/mL) and most sustained reductions in HBsAg were observed in the 75 mg cohort.
  • Single doses of VIR-3434 were generally well tolerated; all AEs were grade 1-2. No clinically significant laboratory abnormalities or changes in liver safety parameters were observed.

Poster Presentation: Kosh Agarwal, M.D., consultant hepatologist and transplant physician at the Institute of Liver Studies, King’s College Hospital (Abstract #28863; Publication #839)

A preclinical analysis of VIR-3434 and the parent molecule of VIR-3434 (HBC34) in in vivo mouse models demonstrated:

  • VIR-3434 neutralized both HBV and hepatitis D virus infection with >5,000-fold higher potency than hepatitis B immunoglobulins in vitro.
  • In an HBV mouse model, the parent molecule of VIR-3434 blocked the spread of HBV infection and reduced HBsAg levels in chronically infected animals.
  • VIR-3434 in complex with HBsAg activated dendritic cells efficiently and induced CD4+ reporter T cell responses – the first steps towards eliciting T cell immunity and potential long-term control via a vaccinal effect."
    https://investors.vir.bio/news-releases/news-release-details/vir-biotechnology-presents-new-data-evaluating-potential-vir

Dear Koreaner,

Unfortunately, there is a limit to the amount of this antibody that can be used. The complex between HBsAg and the antibody is actually quite large becuase it is a complex of the the antibody and either a subviral particle or a viral (Dane) particle.

These “immune complexes” become trapped in the kidney filtration apparatus and if too numerous cause kidney inflammation (nephritis). See Nephritic Syndrome - StatPearls - NCBI Bookshelf for more information.

Thus the use of VIR-3434 (or any other similar antibody approach) will have to contend with this limitation. There is also the problem that there will almost certainly be strains of HBsAg which will not be recognized by VIR-3434 or any other HBsAg specific antibody. These “immune” escape strains of HBsAg are well documented in the literature.

Its also important to set expectations for clinical activity based on results in mouse models of HBV infection. Mouse models are very poorly predictive of the antiviral effects of new investigative therapies (for instance NAPs have no activity in mouse models and yet are the only agent that achieves HBsAg loss in humans). There are many technical reasons for this. I advise you to use clinical efficacy data as the only real and reliable barometer for the antiviral potential of new investigative therapies.

Best regards,

3 Likes

Latest data for Vir 2218 looks promising…but not sure if this data will hold since result is just END OF TREATMENT…

Worth sharing though……

Summary of AASLD 2022 Presentations

Oral Presentation – VIR-2218 in Combination with PEG-IFN-α
Preliminary 48-week safety and efficacy data from novel investigative cohorts of VIR-2218 alone and in combination with PEG-IFN-α in participants with chronic HBV infection demonstrated:

  • Longer duration (48 weeks) of VIR-2218 plus PEG-IFN-α treatment achieved higher rates of HBsAg seroclearance with anti-HBs seroconversion by the end of treatment (30.8%, 4/13).
  • Participants receiving longer duration of VIR-2218 plus PEG-IFN-α had greatest mean declines from baseline HBsAg (log10 IU/mL) levels at week 48 (2.9 ± 1.36).
  • 10 participants receiving VIR-2218 plus PEG-IFN-α achieved HBsAg seroclearance by week 48, and nine achieved anti-HBs levels >10 mIU/mL.
  • Most adverse events (AEs) reported were grade 1 or 2 with no discontinuations due to treatment-emergent AEs.

Dear Nass,

This is interesting data but some points for you (and the community) to note:

  1. The effects of siRNA in chronic HBV are driven by stimulation of innate immunity. There was a recent acknowledgement of this by J&J at one of their poster presentations at AASLD 2022. We also now know that the compound initially designed as an ASO by GSK (bepirovirsen) also works by stimulating innate immunity. This is a reflection of the reality that the genetic plasticity of HBV rapidly neutralizes any drug activity which is dependent on a specific sequence within the HBV genome.

  2. As such, neither bepirovirsen nor siRNA have a direct impact on subviral particles (critical for functional cure). This was also demonstrated directly for the Arbutus siRNA AB-729 at EASL 2021.

  3. Bepirovirsen also achieved HBsAg loss and ALT flares at the end of therapy (~25%) but this declined to 9% after 24 weeks of therapy (also presented at AASLD 2022). This effect was also restricted to patients with low baseline HBsAg.

  4. The effects of siRNA (dsRNA) in achieving HBsAg loss and seroconversion during therapy in the VIR-2218 + pegIFN study also are more potent in patients with low baseline HBsAg (< 1500 IU/mL) which represents only a small fraction of patients.

  5. The GalNAc conjugation used for all siRNA being developed for chronic HBV treatment is known to act as a long lasting depot for residence in hepatocytes. Also the stimulation of innate immunity by double stranded RNA (including siRNA) and resulting antiviral effects are known to persist for many months after a single dose. This “end of treatment” is not really end of antiviral effect for GalNAc conjugated siRNAs.

The unfortunate confusion in the scientific and patient communities alike about these oligonucleotide-based compounds are caused by fundamental flaws in understanding the limitations of these compounds and the nuances of how they have formulated for clinical trial use.

See Viruses | Free Full-Text | Oligonucleotide-Based Therapies for Chronic HBV Infection: A Primer on Biochemistry, Mechanisms and Antiviral Effects for an overview of these issues.

We all want functional cure to be here yesterday but it is also very important to have a good understanding of what is actually happening with these compounds in order to set expectations and hopes.

Best regards,

2 Likes

Thanks availlant…
Thanks for the clarification…
I just saw the data from GSK…was disappointing but they will go ahead with phase 3 but I guess combining with NAC?

I have been reading some of the presentations for this Month AASLD conference to understand how close a cure is… but looks like we are not there yet…hopefully by 2030… Thanks to scientists like you!!..
Nass

Hi Nass,

Actually GSK already tested the GalNAC-conjugated version of bepirovirsen in parallel with unconjugated bepirovirsen in earlier phase II studies (called GSK 3389404). The more efficient delivery of bepirovirsen to infected cells actually lead much worse antiviral activity and development of this compound was abandoned.

Best regards,

1 Like

We have more clinical results regarding VIR-3434 and VIR-2218. They are most encouraging.

I quote from Dr MF Yuen’s AASLD presentation:
Summary of Results
• VIR-2218 alone or in combination with PEG-IFNα was generally well-tolerated
– Majority of TEAEs were Grade 1 or 2
• Ten participants across all cohorts receiving VIR-2218 and PEG-IFNα achieved HBsAg
seroclearance by Week 48
– 9 of the 10 participants achieved anti-HBs levels >10 mIU/mL
• Longer duration of concurrently initiated VIR-2218 and PEG-IFNα regimen (Cohort 5) resulted in
– 30.8% participants achieved HBsAg seroclearance and anti-HBs seroconversion
– Deepest mean HBsAg reductions (-2.9 Log10 IU/mL) at EOT

Dr Ed Gane’s AASLD presentation:
Summary of Results
• VIR-2218 and VIR-3434 combination regimens up to 20 weeks were generally well tolerated and
associated with mostly mild adverse events
• VIR-2218 and VIR-3434 combination regimens achieved mean HBsAg reductions > 2.5 log10 IU/mL
in all cohorts, and absolute HBsAg levels < 10 IU/mL were achieved in most participants
• Patterns of response demonstrate additive HBsAg reduction from the complementary modes of
action of VIR-2218 and VIR-3434
Key Takeaways
• The HBsAg declines achieved with the combination of VIR-2218 plus VIR-3434 are among the
largest seen to date with novel HBV therapies
• These data support the continued evaluation of combination regimens containing VIR-2218 and
VIR-3434 for the functional cure of chronic HBV infection
• Patterns of response suggest that longer durations of treatment may achieve additional reduction
in HBsAg
• Cohorts evaluating longer durations of treatment with VIR-2218 plus VIR-3434 or VIR-3434
monotherapy, as well as regimens evaluating the addition of interferon, are currently recruiting in
this ongoing trial (NCT04856085)

The VIR-2218 and VIR-3434 clinical trials do not have as many patients as in the GSK Bepirovirsen clinical phase 2b trial with 457 participants. The results regarding serum HBsAg reduction, HBsAg seroconversion, and very few serious side-effects are most encouraging

1 Like

Dear Stephen W,

Unfortunately, both of these studies allow enrollment of patients with low baseline HBsAg (< 1000 IU/mL). This is an important limitation which is very important to consider as HBsAg loss is easier to achieve in these patients, both because there is less HBsAg to clear and also because immune function against HBV is stronger in these these patients. Although these studies demonstrate interesting effects, they are not likely applicable to the general patient population where HBsAg is typically > 10,000 IU/mL.

Dr. Yuen’s study does not include a control group with pegIFN alone, which is known to perform better with lower levels of HBsAg present. This is actually an surprising omission in the trial design. We cannot know what part of the performance is coming from pegIFN in the low HBsAg population.

Best regards,

.

Thank you, Dr Vaillant.

I noticed that in the MARCH Study: Evaluating Combinations of VIR-2218
and VIR-3434, Cohort 1 and 2, both have participants with HBsAg level:1,000 - < 10,000 IU/mL, 13 (76.5%) and 3 (75.0%) respectively, while Cohort 3 has 10 (52.6%). So there are participants with HBsAg > 1,000 iu/mL.

In the Phase 2 Trial Evaluating VIR-2218 With and Without PEG-IFNα, the
HBsAg, mean (SD), Log10 IU/mL for Cohort 1: 3.4 (0.5), Cohort 2: 3.2 (0.7), Cohort 3: 3.3 (0.7), Cohort 4: 2.9 (0.8), and Cohort 5: 3.4 (0.7), which seem to indicate again there are participants with HBsAg > 1,000 iu/mL.

It does seem that a low baseline Serum HBsAg works well for many drug candidates, even for stopping NA treatment. I read a recent editorial by Dr Anna Lok that after many years of NA treatment, the number of hepatocytes with cccDNA is actually very low and that the bulk of serum of HBsAg comes from integrated hbvdna. Since serum HbsAg is by itself harmless, this may call for a new definition of a functional cure.

It is my understanding that we need drugs to lower serum HBsAg, to below zero as your experiences with NAP suggested, in order to rekindle the immune system to control/eliminate the infected hepatocytes(hence the ALT flares?). So the HbsAg lowering drugs need not be used for a long time, they are just needed to provide a window of opportunity for the immune system to work(as in adult HBV infection). So far there are no alternatives to Interferon used in clinical trials to kickstart the immune system at low or zero HBsAg level. I hope this will change in the future.

Hi @Stephenw
Thanks for sharing additional details… it will be interesting to see phase 2b results which is due mid next yr.

As Dr. availlant mentioned, there is a limitation for the HBsAG reduction and you can see that from their graph…but it will be interesting to see results from the 2nd phase since they are combining Vir 2218 with 4 other regimes…

There are lot of good progress…but was disappointed with the GSK results…but they decided to go ahead with phase 3……

Nass

Yes, the GSK results were disappointing since there was a 60% reduction in efficacy. I guess that is the problem with small clinical trials. I am looking forward to the Phase3 trial.

Dear Stephen W,

You can look at these trials on www.clinicaltrials.gov and you will see that the exclusion criteria for HBsAg is either absent or very low in these studies.

HBsAg is not harmless: it blocks immune function from establishing control over HBV infection and with the prolonged exposure to HBsAg, some HBV-specific aspects of the immune system either get put to sleep or deleted from the immune system. HBsAg also contributes to the development of HCC and its persistence indicates chromosomal damage from integration of HBV genomes, which also drives HCC.

Yes it is true that long term NUC therapy INACTIVATES cccDNA and does have erosive effects on cccDNA copy number inside hepatocytes but rapid rebound of viral infection is well shown to rebound rapidly (even when cccDNA is not detectable in the liver) when HBsAg is present after removal of NUC or NUC + CAM therapy. This is because very low levels of latent cccDNA will always be present in the liver and are fully capable of reestablishing infection if HBsAg persists.

This is why the definition of functional cure will not change. More than 20 years of clinical data clearly shows that HBsAg loss during therapy and persisting after therapy is removed is an essential criteria for long term immunological control and the elimination of integrated HBV DNA which dramatically lowers the risk for HCC.

NAPs are the only agent where HBsAg loss occurs regardless of baseline HBsAg (even with > 125,000 IU/mL). We also only allow patients with HBsAg > 1000 IU/mL in our trials to avoid the confounding issues which are present in most recent clinical trials.

The HBsAg reduction limitation that Nass has noticed in these clinical trials is a feature of all siRNA drugs as they cannot target subviral particles. Only NAPs do this currently.

Best regards,

1 Like

Thanks, once again.

I quote from Anna Lok: " The findings from Grudda et al. (15) and other studies showing that iDNA [integrated hbvdna]can be a predominant source of HBsAg in some patients, particularly those who are HBeAg-negative (12), and the low rates of HBsAg loss achieved in ongoing trials of emerging therapies that specifically target HBsAg (17), have raised the question whether HBsAg loss is a valid definition of functional HBV cure and if it is achievable."

According to Vir Biotechnology: “VIR-2218 has also been designed to target HBV’s X gene region, shared by all HBV RNAs, for broader activity.” I take it to mean that VIR-228 will target all HbsAg mRNAs.
GSK’s bepirovirsen “binding site (GCACTTCGCTTCACCTCTGC) is present in all HBV mRNA and pregenomic RNA; as such, bepirovirsen would be expected to reduce levels of all HBV mRNAs including pregenomic RNA”.

So it seems that both Vir-2218 and bepirovirsen can reduce the HBsAg required for subviral particles. NAP is indeed the most potent agent to reduce serum HBsAg, and we look forward to a Phase 3 clinical trial.

Hi Stephen,

Unfortunately, Dr. Lok’s suggestion is born out of the failure of all new agents (with the exception of NAPs) to achieve functional cure rather than any new clinical data suggesting that a change in the definition is appropriate, especially for the long term benefit of patients. The current definition of functional cure reflects the realities of the substantial clinical data for more than 20 years. Historically, HBsAg loss (and liver enzyme elevations signalling the removal of integrated HBV DNA) are essential during therapy to maintain immunological control off therapy. Continued HBsAg loss off therapy is still the gold standard for remaining disease free with liver healing, the lowest risk for HBV reactivation and the lowest risk for HCC. See here. There has been no new data to provide a clinical justification for altering this definition.

I suggest you see my recent reviews on these subjects here and here.

Without HBsAg loss, there will be the need for lifelong antiviral therapy (but still the risk of HCC). We already have very good drugs for this: ETV, TDF and TAF.

You are correct that siRNA and antisense were designed to degrade HBV mRNA, however there are two fundamental problems in HBV with these approaches:

  1. Unlike other viruses, HBV replication has no proofreading function so mutations are very common, driving the evolution of thousands of HBV quasispecies in all patients even in the absence of therapy. siRNA and antisense lose all of their activity with a single nucleotide mismatch between the guide sequence and the target mRNA sequence. The presence of these escape mutants in S and X sequences targeted by JNJ-3839 prior to therapy was recently disclosed at AASLD 2022 (abstract 1213) forcing J&J to admit that the HBsAg declines in these patients was not occurring by an RNAi mechanism. Of course this will be the case for all sequence-dependent approaches in HBV: antisense, siRNA, CIRSR-Cas9 and ARCUS endonucleases. In HBV this includes bepirovirsen, JNJ-3839, VIR-2218, AB-729 and RG6346.

  2. Active cccDNA (the genetic reservoir of viral replication) turns over very rapidly, allowing rapid fixation of escape mutants under selection pressure of antisense or siRNA resulting in rapid rebound on therapy. This was demonstrated in animal systems which model this genetic plasticity many years ago and in the first clinical trial with siRNA (ARB-1467) where viral rebound occurred rapidly, even with three siRNA triggers used in combination.

All of the clinical data presented to date has actually formally excluded the presence of ASO or siRNA mechanisms in the HBsAg responses observed with these agents. These are too numerous to get into this post but some important ones are:

  1. The presence of ASO / siRNA escape mutants prior to therapy discussed above.
  2. The formal demonstration that siRNA does not result in declines in SVP (AB-729) by HBsAg isoform analysis.
  3. With bepirovirsen, antiviral activity is lost when this ASO is more efficiently targeted to hepatocytes (GSK 3389404) which is now abandoned by GSK.

Your confusion is understandable. All of these presentations are made by well known clinicians who have a lot of experience in testing HBV drugs but who are not well versed in oligonucleotide biochemistry, pharmacology or the pharmacological responses to these agents which are well conserved in many other liver diseases.

What is missed by all of these clinicians is the well documented immunostimulatory properties possible with ASOs and inherent in all RNAi (because they mimic the double stranded RNA found in many viruses).

Previous efforts to develop siRNA for influenza in patients demonstrated that the only antiviral activity possible with this approach was from the immunostimulatory properties of RNA and not from the RNAi mechanism.

GSK has formally acknowledged that the HBsAg response to bepirovirsen is occurring via stimulation of innate immunity (which is why it only shows activity in patients with low baseline HBsAg). Arbutus has acknowledged the immunostimulatory properties of AB-729.

In fact all of the clinical data to date very clearly points to these agents acting as simulators of innate immunity (all RNAi) or innate and T-cell mediated immunity (bepirovirsen).

I encourage you and the community to read the recent review I published here on all of these issues which will give you a much better understanding of why functional cure is so difficult to achieve with sequence dependent oligonucleotide approaches.

Best regards,

1 Like

Thank you Dr Vaillant for your response and the links to your reviews. I will study these reviews, it will take a while to read up and understand all these issues.

I like to make some comments regarding the definition of a functional cure. The first aim of a cure is to eliminate all cccDNA. This may be achieved after long-term use of NA as the production of new Dane particles(released then re-infect) and nucleocapsids with hbvdna that recycle to the nucleus are deeply suppressed, and also due to the fact that some cccDNA may be lost during mitosis in the natural liver cells turnover. So, it is possible that some patients may have no cccDNA and yet will still test positive because of HBsAg produced by integrated hbvdna. In that case, these patients are cured of HBV, and the HBsAg being produced by integrated hbvdna is itself harmless, even though they may still suppress the body’s immune system against HBV.
In theory, patients with zero cccDNA need not be treated. It worries me deeply if we try to eliminate integrated hbvdna in order to make patients HBsAg negative. We are told that cccDNA can be degraded without killing the liver cell, but I doubt whether integrated hbvdna can be degraded as it is actually part of the human genome. So, it seems to me that the only way to remove integrated hbvdna is by killing the liver cell. Is this the reason we have ALT flares during functional cures?

I read the 2022 AASLD Abstract 1213 - VIRAL SEQUENCE ANALYSIS OF
NOT-CURRENTLY TREATED (NCT) CHRONIC HEPATITIS B (CHB) PATIENTS ENROLLED IN
THE REEF-1 STUDY AND IMPACT OF BASELINE NUCLEOTIDE POLYMORPHISMS IN THE
SMALL INTERFERING RNA (siRNA) JNJ-3989 TRIGGER TARGET REGIONS ON VIRAL ANTIGEN DECLINES. It concludes that: Baseline nt polymorphisms in the JNJ-3989 S-and
X-trigger target region were present in~10% of NCT patients and had no apparent impact on JNJ-3989 induced viral antigen declines.
So, it seems to indicate no escape mutants.

I also read that: “GSK3389404 showed dose-dependent reduction in hepatitis B surface antigen, with an acceptable safety profile. While no clear optimal dose was identified, the findings from this study may help in the development of improved treatment options for patients with chronic HBV infections.”
It seems to me GSK 3389404 was abandoned due to the failure to identify an optimal dosage.

GSK did admit that bepirovirsen that:
Conclusion: TLR8 agonism of BPV was confirmed preclinically. Cytokines/chemokines changed by BPV treatment in the Phase 2a study indicate that an immunostimulatory activity of BPV via TLR8 may be correlated with ASO-mediated HBsAg reduction. These findings support further investigation of a combination of HBsAg reducing agent and TLR8 agonist for treating HBV."

GSK is saying “immunostimulatory activity of bepirovirsen may be mediated through TLR8; this mode of action may explain differences seen as compared with other new HBV therapies. These findings may represent progress in the search for achieving a functional cure”
GSK is claiming this immunostimulatory as an added feature to ASO antigen reduction.

Once again, thank you.

Stephen…i didn’t know certain patients don’t have cccDNA …
I just ordered my HBsAG quantitative level per Dr Gish recommendation to be ready for treatment….fingers crossed!!

Good stuff to read …Thanks to active members like you…and Thanks to Dr @availlant for his detailed information about the progress made so far…